Aspergillus туысына жататын саңырауқұлақтардың эндоглюконаза гендерін прокариот жүйесінде экспрессиялау және клондау

РЕФЕРАТ
КІРІСПЕ
1 ӘДЕБИЕТКЕ ШОЛУ
1.1 Aspergillus туысы саңырауқұлақтарына жалпы сипаттама
1.2 Өсімдік биомассасының негізгі компоненттерінің құрылымы мен қасиеттері
1.3 Полиферментті целлюлазалық комплекс
1.4 Целлюлазалардың белсенділігіне әсер ететін факторлар
1.5 Целлюлазалардың адсорбциялану қасиеттері мен домендері
1.6 Эндоглюканазалар
ЭКСПЕРИМЕНТТІК БӨЛІМ
2 МАТЕРИАЛДАР МЕН ЗЕРТТЕУ ӘДІСТЕРІ
2.1 Материалдар
2.2 Зерттеу әдістері
3 ЗЕРТТЕУ НӘТИЖЕЛЕРІ ЖӘНЕ ОЛАРДЫ ТАЛҚЫЛАУ
3.1 Aspergillus niger IFO31125 саңырауқұлағының эндоглюконаза ферментін кодтайтын eng1 генін прокариот жүйесінде клондау
3.2 ENG1 рекомбинантты эндоглюканазаның E.сoli Rosetta(DE3) штаммындағы экспрессиясы
3.3 ENG1 рекомбинантты эндоглюканазаның ферментативтілік белсенділігін анықтау
ҚОРЫТЫНДЫ
ҚЫСҚАРТЫЛҒАН СӨЗДЕР
ПАЙДАЛАНЫЛҒАН ӘДЕБИЕТТЕР ТІЗІМІ
Соңғы жылдары дүние жүзінде этил спирті өндірісінің қарқынды дамуы байқалынды. Бұл этил спиртінің биожанармай ретінде қолданылуына байланысты болып келеді. Бензин-этанол қоспасын жанармай ретінде қолдану бұрыннан белгілі болып келген. Қазіргі кезде де АҚШ пен Еуропа елдерінде 10 % және 20 % этанол бар бензин қоспасын жанармай ретінде кең қолданады. Отынның бұл түрі ішкі жану қозғалтқыштарының құрылымдарын өзгертпей, оларды сол күйінде қолдана беруге мүмкіндік береді. Бразилияда мыңдаған көліктер этанолды жағу арқылы жұмыс істейді. Бұл үрдіске басты себеп ретінде жетпісінші жылдары туындаған кризис болатын. Қазақстан үшін биожанармай өндірісі Батыс елдері үшін сияқты дәл осы уақытта соншама маңызды болып тұрған жоқ (өйткені қазіргі таңда республика үшін ең басты энергия көздері – бұл мұнай мен газ болып отыр). Дегенмен мұнай мен газ қорларының сарқылатындығына қарағанда, Қазақстанда биоэтанол шикізаты – целлюлозаның қоры шексіз деп айтуға болады. Сол себепті Қазақстан үшін целлюлоза қорларын пайдалану – экономикалық жағынан таптырмайтын пайда болып табылады. [13]
Этил спиртін дәстүрлі жолмен өндіру кезінде құрамында крахмалы бар шикізат және қант (меласса) қолданылады. Крахмалды шикізат – бұл, негізінен, астық тұқымдастары (бидай, арпа, сұлы), күріш, жүгері және көп жағдайда - картоп. Келтірілген шикізаттың барлығы да азық-түлік көздері болып табылады. Азық-түлікке деген сұраныстың жоғарылауын еске алатын болсақ, спиртті целлюлозадан алу - өте перспективті әдіс. Бұл шикізат түрінің артықшылығы – оның қайтадан қалпына тез келуіне байланысты: дүние жүзінде жыл сайын 100 млрд. т. целлюлоза жинақталса, крахмал – 1 млрд., ал қант – 0,1 млрд. т. Осы фактілерге сүйенетін болсақ, этил спирті өндірісі үшін целлюлозды шикізатты қолдану өте өзекті болып келеді.
Этил спиртін қанттарды, негізінен, глюкозаны, энзимдер мен ашытқылардың қатысымен ашыту арқылы алады. Глюкоза бастапқы шикізатта болуы мүмкін немесе оны полисахаридтерді – крахмал мен клетчатканы гидролиздеу арқылы алады. Қазір спирт өндірісінде азық-түлік өнімдерін целлюлозалы шикізатпен ауыстыру технологиялары белсенді түрде іздестірілуде, ал целлюлоза көптеген өндірістердің қалдығы болып табылады (орман шаруашылығы, ағашты өңдеу өндірісі, қағаз жасау өндірісі, т.б.).
1. Алешина Л.А., Глазкова С.В., Луговская Л.А., Подойникова М.В., Фофанова А.Д., Силина Е.В. “Современные представления о строении целлюлоз” // Химия растительного сырья. - 2001. №1: 5–36 б
2. “Реставрация произведений графики”. ВХНРЦ им. И.Э.Грабаря, М., 1995: 300 б
3. А.П. Синицын, А.В. Гусаков, В.М. Черноглазов. Биоконверсия лигноцеллюлозных материалов: Учеб. пособие. М.: Изд-воМГУ, 1995: 59-65 б
4. Aspergillus niger морфологиясы // Internet. - http://dic.academic.ru/dic.nsf/enc_biology/1845/Род#sel=
5. Aspergillus туысының анықтамасы // Internet. - http://en.wikipedia.org/wiki/Aspergillus
6. Aspergillus niger саңырауқұлағының морфологиясы // Internet. - http://citricacid.ru/aspergillus-niger/morphology/ -
7. В. В. Будаева, Р. Ю. Митрофанов. Н. В. Золотухин. “Исследование ферментативного гидролиза отходов переработки злаков”, Ползуновский вестник, №3, 2008: 28б
8. Стайкова Д. Д. “β-глюкозидазы гриба Aspergillus terreus: характеристика множественных форм, их биосинтез и секреция”. Диссертациялық жұмыс,1995:5 б
9. М.Л. Рабинович, М.С. Мельник. “Хвостатые ферменты”, Природа, №5, 2003: 5б
10. А.В. Гусаков, А.П.Синицын. “ О механизме действия ферментов-целлюлаз на текстильные материалы: взгляд энзимологов”. Текстильная химия, 1998: 52 б
11. М. Л. Рабинович, М. С. Мельник. “Прогресс в изучении целлюлолитических ферментов и механизм биодеградации высркрупорядоченных форм целлюлозы”, Успехи биологической химии, т. 40, 2000: 205 б
12. Л. С. Гальбрайх “Целлюлоза и ее производные”, Химия. Мәскеу, 1996: 10б
13. Б. Я. Глик, ДЖ. Пастернак “Молекулярная биотехнология”, Мир 2002: 294-296 б
14. Маниатис Т., Фрич Э., Сэмбрук Дж. “Молекулярное клонирование. Методы генетической инженерии” – М.:Мир, 1984. – 463 б
15. А. Е. Кузнецов, Н. В. Градова “Научные основы экобиотехнологии”. Мәскеу, Мир, 2006: 407 – 409 б
        
        Қазақстан Республикасының Білім және ғылым министрлігі
Әл-Фараби атындағы Қазақ Ұлттық Университеті

Кафедра меңгерушісі, б.ғ.д.,
профессор ... ... З.Г ... ... ... ... ... саңырауқұлақтардың эндоглюконаза гендерін прокариот жүйесінде экспрессиялау және клондау
050701 мамандығы бойынша
4 курс студенті ... ... ... ... ... ... Бисенбаев А.Қ.
(күні, қолы)
Норма бақылаушы: ... Г.Ж. Т ... ... ... ... 42 беттен тұратын компьютерлік тексттен тұрады. 16 сурет, 4 кесте келтірілген, 28 ... ... ... оның 11 шетел әдебиет көзі.
Жұмысты жасау үшiн объект ретiнде Aspergillus niger ... ... ... ... ... ... қолданылады.
Өзектілігі: Мұнай құнының күрт шарықтауы, әлемдік мұнай мен газ қорларының ... ... ... көздерін іздестіру жұмыстарына қызығушылықты арттыра түсірді. ... ... ... ... жұмыстарының алдына қойған мақсаты қайта қалпына келетін органикалық шикізаттан биотехнологиялық ... ... ... ... ... биоэтанол алу болды. Этанол бензинге қарағанда жоғары октандық санға ие, адам үшін токсикалық ... ... ... орай ... ... ... ... бәсекеге қабілетті альтернатива бола алатындығы және олардың автомобильді транспорттың қажеттілігіне қолданылуы болжалданады.
Жұмыстың мақсаты:
Aspergillus туысы саңырауқұлақтарының эндоглюканаза ферментін сипаттау және оны ... ... ... ...
* ... туысы саңырауқұлақтарының мицелийінен нуклеин қышқылдарын бөліп алу.
* Aspergillus саңырауқұлағының эндоглюканаза гендерін амплификациялау үшін ... ... және ... ... ... Бөлініп алынған нуклеин қышқылдары препараттарын талдау және целлюлаза гендерін PCR көмегімен амплификациялау.
* Генді векторға енгізіп, ... ... ... ... ... ... ... барысында қолданылған әдістемелер: Aspergillus niger саңырау-құлағынан тотальдік ... ... ... ... алу, ... ... ... poly-A байыту, кері транскрипция әдісімен кДНҚ алу, PCR әдісі арқылы амплификациялау, рекомбинантты ДНҚ молекуласын құрастыру және оны E.сoli ... ... ... E.сoli клеткасында экспрессиялануын белок препаратын ДСН-ПААГ электрофорезі арқылы анықтау.
Кілтті сөздер: эндоглюканаза, целлюлоза, целлюлазалық комплекс, Aspergillus туысы, биоэтанол, ... ... ... саңырауқұлақтарына жалпы сипаттама
6
1.2
Өсімдік биомассасының негізгі компоненттерінің құрылымы мен ... ... ... ...
13
1.4
Целлюлазалардың белсенділігіне әсер ететін факторлар
15
1.5
Целлюлазалардың адсорбциялану қасиеттері мен ... ... МЕН ... ... ... ... ... ЖӘНЕ ОЛАРДЫ ТАЛҚЫЛАУ
29
3.1
Aspergillus niger IFO31125 саңырауқұлағының эндоглюконаза ферментін кодтайтын eng1 ... ... ... клондау
29
3.2
ENG1 рекомбинантты эндоглюканазаның E.сoli Rosetta(DE3) штаммындағы экспрессиясы
34
3.3
ENG1 рекомбинантты ... ... ... ... ... ... ... жылдары дүние жүзінде этил спирті өндірісінің қарқынды дамуы байқалынды. Бұл этил спиртінің биожанармай ретінде қолданылуына байланысты болып ... ... ... ... ... ... ... белгілі болып келген. Қазіргі кезде де АҚШ пен Еуропа ... 10 % және 20 % ... бар ... ... ... ретінде кең қолданады. Отынның бұл түрі ішкі жану қозғалтқыштарының құрылымдарын өзгертпей, оларды сол күйінде қолдана беруге ... ... ... ... ... этанолды жағу арқылы жұмыс істейді. Бұл үрдіске ... ... ... ... ... туындаған кризис болатын. Қазақстан үшін биожанармай өндірісі Батыс елдері үшін сияқты дәл осы уақытта соншама маңызды ... ... жоқ ... ... ... ... үшін ең ... энергия көздері - бұл мұнай мен газ болып отыр). Дегенмен ... мен газ ... ... ... Қазақстанда биоэтанол шикізаты - целлюлозаның қоры шексіз деп айтуға болады. Сол себепті Қазақстан үшін целлюлоза қорларын ... - ... ... ... пайда болып табылады. [13]
Этил спиртін дәстүрлі жолмен өндіру кезінде құрамында крахмалы бар шикізат және қант ... ... ... шикізат - бұл, негізінен, астық тұқымдастары (бидай, ... ... ... ... және көп ... - ... Келтірілген шикізаттың барлығы да азық-түлік көздері болып табылады. Азық-түлікке деген ... ... еске ... болсақ, спиртті целлюлозадан алу - өте перспективті әдіс. Бұл ... ... ... - оның ... ... тез ... ... дүние жүзінде жыл сайын 100 млрд. т. целлюлоза ... ... - 1 ... ал қант - 0,1 ... т. Осы ... ... болсақ, этил спирті өндірісі үшін целлюлозды шикізатты ... өте ... ... ... ... ... қанттарды, негізінен, глюкозаны, энзимдер мен ашытқылардың қатысымен ашыту ... ... ... ... шикізатта болуы мүмкін немесе оны полисахаридтерді - ... мен ... ... арқылы алады. Қазір спирт өндірісінде азық-түлік өнімдерін целлюлозалы шикізатпен ауыстыру технологиялары белсенді түрде іздестірілуде, ал целлюлоза көптеген өндірістердің қалдығы ... ... ... ... ... өңдеу өндірісі, қағаз жасау өндірісі, т.б.).
Глюкозаны целлюлозаға дейін екі жолмен гидролиздеуге ... ... және ... Целлюлозаның химиялық гидролизі қышқылдардың қатысуымен жүзеге асады, сол ... осы ... ... ... ... ... проблемалардың біріне айналады. Сонымен қатар реакцияның соңғы өнімін қышқылдар мен бөгде қосылыстардан тазартылуын өте қатаң қадағалау қажет, ... ... ... ... ... реакторға түскен қышқылдар спирттік ашытуды жүргізетін ашытқыларға кері әсер етіп, реакцияны тежеуі мүмкін.
Ферментативті гидролиз процесстерін практикада қолдану үшін ферменттердің ... ... ... алу ... ... ... активтендіріп, ферментация процесстерінің параметрлерін оптимумға келтіру қажет. Ферментативті гидролиз ... ... ... ... ... дегенмен ферментативті үрдіс гидролизді селективті өткізуге мүмкіндік береді және химиялық гидролизге қарағанда қосымша бөгде заттардың түзілуіне алып ... ... ... ... ... асыру үшін целлюлазалық ферменттердің продуценттерін тауып, олардың ішінен ең оптимальды продуцентті таңдау маңызды. Табиғатта целлюлазаларды өндіретін организмдер көп ... ... ... ... ... масштабта қолдануға келмейді. Целлюлаза продуценттері ішінен ең қолайлы объектілерінің бірі - Aspergillus туысына жататын саңырауқұлақтар. ... ... ... ... ... аса ... дақылдандыру жағдайларын қажет етпейді. Сонымен қатар, бірқатар дерек көздері бойынша Aspergillus ... ... ... ... ... және де ... комплекстің ішінен эндоглюканаза ферменттерін жоғары деңгейде синтездейтіні белгілі [8]. Сол себепті осы саңырауқұлақтардың эндоглюканаза ферменттерін қолданып, биоэтанол ... ... ... - аса ... ...
1 ӘДЕБИЕТКЕ ШОЛУ
1.1 Aspergillus туысы саңырауқұлақтарына жалпы сипаттама
Аспергилл туысы (Aspergillus)
Ғылыми классификациясы:
Домен: ... ... ... асты: Pezizomycotina
Класс: Eurotiomycetes
Қатар: Eurotiales
Тұқымдас: ... ... ... ... ... рет 1729 ж. ... микологы П.Микеллимен сипатталған) - ең көп ... ... ... ... ... ету ... - ... беткі қабаты, әсіресе оңтүстік өңірлерде. Дегенмен оларды ... ... ... ... ... ... ... болады, колониялар пайда болуы үшін бұл саңырауқұлақтарға жоғарғы ылғалдылық жеткілікті. Аспергиллдердің ... - ... ... бұл ... адам мен ... ... тіршілік ететін түрлер кездеседі. [4]
* - ... niger, 2 - A. flavus, 3 - ... ... 4 - P. ... 1 - ... пен ... ... колониялары
(Aspergillus niger морфологиясы // Internet. - http://dic.academic.ru/dic.nsf/enc_biology/1845/%D0%A0%D0%BE%D0%B4#sel= )
Аэробты микроорганизмдер, әртүрлі субстраттарда жақсы өседі. ... ақ ... ... ... ... ... ... жатқызылатын түріне байланысты, алуан түрлі түстерге боялуы мүмкін, бұл саңырауқұлақтың метаболиттері мен спора түзу процесстеріне байланысты (Сурет 1). ... ... өте ... ... ... ... ... тән пердешелері болады. Барлық класс саңырауқұлақтары сияқты, ... де ... ... ... споралармен көбейеді. Дегенмен Aspergillus fumigatus жынысты жолмен көбейе алады.
Табиғатта өте кең ... ... ... ... жоғары. Ылғалды бөлмелердің қабырғаларында болатын қара "дақтар" - бұл, ... ... беру ... ... Aspergillus niger.[5]
Aspergillus niger морфологиясы.
Aspergillus niger қалталы саңырауқұлақтар классына (Ascomycetes), аспергиллдер тұқымдасына (Aspergillaceae), Aspergillus туысына жатқызылады (бұл түрден ... осы ... 120 түр ... Саңырауқұлақ денесі түссіз, қатты тармақталған және бір-бірімен өрілген жіпше- гифалардан тұрады, бұл гифалар жиналып, мицелий түзеді. ... ... - ... ... клеткаларға бөлінген. Гифтер диаметрі 3-тен 6 мкм-ге дейін (Сурет 2).
Аспергиллдер үшін беткі өсу тән, бірақ ... ... мен ... ... өте қатаң сақтаған кезде қатты және сұйық ортаның ішінде де көбейе алады.
1 - ... 2 - ... ... ... 3 - көпіршік; 4 - бірінші қатар ... 5 - ... ... ... 6 - ... 7 - ... клеткалары.
Сурет 2 - Aspergillus niger
(Производство лимонной кислоты // Internet. - http://citricacid.ru/aspergillus-niger/morphology/)
Беттік өсірілу кезінде мицелийден ... ... ... ... ... ... - конидийлер орналасатын өсінді бөліктері ортадан көтеріліп тұрады. ... ... ... - бұл ... ... септелмеген, сыртқы беті түйіршікті, ұзындығы 2000 және одан да ұзын болатын гифтер. Алдымен конидий ... ... ... конидий жиынтығының негізі болатын "көпіршік" пайда болады. Көбіршік дөңгеленіп, 400 мкм-ге дейін жетеді, оның үстіңгі бөлігінде ұзынша келген бірядролы немесе ... ... - ... түзіледі. Стеригмалардың бос ұштарында тізбек түрінде одан да ұсақ клеткалар - конидийлер пайда болады. Осылай өсіндінің ... ... суы ағып ... ... ... Дегенмен аспергилл терминінің дәл аудармасы - "сабалақ жүнді".
Конидийлер - ... ... ... ... шар тәрізді немесе эллипс тәрізді, көлденең кесіндісі 4 мкм болатын тыныштықта жатқан клеткалар. Конидийлердің беті - ... ... ... тікенді, қара (саңырауқұлақтың niger аталуы да содан) немесе қара-қоңыр түсті. Конидийдің түсі барлық конидий ... ... ... ... етеді. Әрбір басында орналасқан конидийлердің саны 10 мыңға дейін жетеді.
Жетілген конидийлер өскіннің басынан ауаның немесе су ағымы ... өте ... ... ... ... Сұйық қоректік ортаға түскенде, олар алдымен ісінеді, кейін бір немесе екі өскінше (гифтер) түзіп өне бастайды, қатты қоректік ... ... ... болса, бірден өскін шығара бастайды. Гифа бос ұшында өсе ... ... ... ... ... ... да, олар өз ... ұзарып, бір-бірімен тығыз байланысып, көзбен көрінетін колонияларды түзеді. 16 - 20 сағ ... ... ... кейін одан конидий түзушілер дамитын ерекше клеткалар пайда болады. Жетілген конидийлердің пайда болуы тек 3 - 4 ... ... ғана ...
A. ... ... қарастырылған көбею тәсілі "жыныссыз" деп аталады. Жалпы, аспергиллдер жеміс денелерінде пайда ... ... ... ... жолмен де көбеюге қабілетті. Сонымен қатар гифадан үзілген бір бөліктен жаңа мицелий өсіп шыға алады, бұл ... ... ... ... ... ... негізгі компоненттерінің құрылымы мен қасиеттері
Барлық жер бетіндегі өсімдіктердің структуралық каркасы лигнин, гемицеллюлоза және целлюлоза ... ... Олар ... ... ... ... ауыл ... ағаш өңдеу өнеркәсіптерінің және адам күнделікті шаруашылық іс ... ... да ... ... ... биомассасының басым көпшілігін құрайтын лигноцеллюлозалық материал түзеді.
Целлюлоза ( лат. cellula - бөлме, осында -- клетка) - клетчатка, ... ... ... ... ... глюкза моносахаридынан тұратын полисахарид. Целлюлоза өсімдік тіндеріне механикалық беріктік, серпімділік қасиет береді. Ол өсімдіктерде қарапайым көмірсулардан ... ... ... ... ... ... ... массасы қай өсімдіктен алынғанына байланысты бірнеше миллиондаған көміртектік бірлікке дейін барады. Оның молекуласының ... ... ... ... ... зығыр, кендір, т.б. талшықты материалдардың целлюлозадан түзілетіндігі осыған байланысты.
Сурет 3- Целлюлоза молекуласының құрылымы
Әрбір ... ... ... ... ... ... 180о ... және онымен -О- оттекті көпірше арқылы гликозидтік байланыспен байланысқан. Осылай бүкіл молекула ұзын тізбек түрінде болады. Тізбектің әрбір бөлігі ... цикл ... ... Осы ... циклдың конформациясы кеңістікте жазықтық бойымен түзу орналаспайды, ол целлюлоза молекуласы үшін ең тұрақты әрі қолайлы "кресло" ... ... ... ... ... 3 ... ... бар (Сурет 3).
Гидроксил топтары Н-сутегіні көпір ретінде қолданып, мықты ... ... ... ... ... сол ... целлюлозада молекулалар арасындағы байланыс энергиясы өте жоғары, ал целлюлоза материал ретінде үлкен беріктік және тығыздық ... ие ... ... ... ... ауадан су буларын сіңіріп, целлюлозаға көпатомды спирттердің қасиеттерін тән ... ... ... ... оның молекулалары арасындағы сутектік байланыстар ыдырап, молекулалардың тізбектері судың әсерінен (немесе сіңірілген басқа да реагенттен) бір-бірінен алшақтайды да, жаңа байланыстар - су мен ... ... ... ... ... ... ... целлюлоза - тығыздығы 1,54-1,56 г/см3 болатын қатты зат, ... ... - су, ... ... ... ... ... т.б. ерімейді. Табиғи талшықтарда целлюлозаның кристаллдану дәрежесі 70% жетіп, аморфты-кристаллдық құрылымда болады.
Целлюлозаның қатысуымен жүретін химиялық реакцияларда, негізінен, үш -ОН тобы ... ... ... ... ... ... өте ... факторлар әсер еткенде кіріседі, бұл факторлар - жоғарғы температура, концентрлі қышқылдар, ... ... ... ... 130оС ... ... оның ... тек аз мөлшерде ғана өзгереді. Бірақ 150-160оС температурада целлюлозаның баяу ыдырауы - деструкциясы басталады да, 160оС ... ... бұл ... өте тез өтіп ... ... ... (оттегі атомы бойынша), молекулалардың одан да қатты ыдырауымен сипатталады.
Қышқылдар целлюлозаға әртүрлі әсер етеді. Мақта целлюлозасын концентрлі азот және ... ... ... ... - ОН ... ... кірісіп, нәтижесінде целлюлозаның азотқышқылды эфирлері - нитроцеллюлоза пайда ... ол ... ... ... ... әртүрлі қасиеттермен ерекшеленеді. Нитроцеллюлозалардың ішіндегі ең танымал өкілдері - бұл оқ-дәрі жасауда ... ... мен ... ... ... бірнеше қоспа қосылған пластмасса - целлулоид. [1]
Химиялық ... тағы ... түрі бұл ... тұз немесе күкірт қышқылдарымен өңдегенде байқалады. Бұл минералды қышқылдардың ... ... ... ... ... целлюлоза молекулаларының деструкциясы бастау алады, реакцияға су молекулалары да ... ... ... ... қоса ... ... 4).
Сурет 4 - Қышқыл ортада жүретін целлюлоза деструкциясы
Минералды қышқылдармен қайнату арқылы жүретін толық гидролиз глюкозаның түзілуіне алып келеді. Целлюлозаның ... емес ... ... - бұл ... ... ... ... беріктігімен сипатталатын гидроцеллюлоза, беріктіліктің төмендеуінің себебі - беріктілік қасиеттері полимер молекуласының тізбегі қысқарған ... ... ... ... және ... қышқылдардың әлсіз ерітінділері (0,5%-дық) 70оС дейінгі температураларда әсер етеді, егер одан кейін оны шаятын ... ... ... әсер ...
Сілтілерге (сұйылтылған ерітінділерге) целлюлоза тұрақты болып келеді. Концентрациясы 2-3,5% болатын күйдіргіш натр ерітінділерін ескірген мата қалдықтарынан ... ... ... кең ... ... (бөлме немесе одан да төмен) температураларда целлюлозаға концентрлі қышқылдардың ... ... 1844ж Дж. ... ... бұл мерсеризация құбылысы маталардың қасиеттерін жақсарту үшін қолданылады. Талшықтарды 20оС 17,5% күйдіргіш натрмен өңдейді. Целлюлоза молекулалары сілтіні қосып ... ... ... ... процесс кезінде целлюлоза көлемін үлкейтіп қатты ісінеді. Осындай өңдеуден ... ... ... ... ... ... болып, түрлі бояғыштарды өзіне жақсы сіңіруге өте қабілетті болады.
Жоғары температураларда оттнгінің қатысуымен концентрлі қышқылдар ... ... ... жүретін целлюлозаның деструкциясын туғызады.
Целлюлоза - глюкоза қалдықтарынан тұратын ... ... ... ... тек ... қалдықтарынан тұратын целлюлоза моделі - бұл идеальды вариант. Табиғатта өсімдік шикізатында осы модельден көп не аз ... ... ... жиі ... ... ... урон қышқылдары, моносахаридтердің басқа да қалдықтары болуы мүмкін.
Целлюлоза макромолекуласында глюкоза қалдықтарының саны "полимеризациялану дәрежесі" деп аталады және n индексіменен ... Оның ... ... ... ... ... Мысалы, мақтада n 5000-12 000 болса, зығыр, ... бұл ... 20 000 - 30 000 ... ... n ... көр ... целлюлоза соғұрлым мықты әрі берік болады.
Дегенмен егер целлюлозаны белгілі бір өсімдік түрінен алынған материал ретінде қарастыратын ... - ... ... ... ... немесе ағаш, онда целлюлоза молекулалары әртүрлі ұзындыққа, әртүрлі полимеризациялану дәрежелеріне ие ... ... яғни ... ... ... және ұзын тізбектер де болады. Кез келген техникалық целлюлозаның ... ... ... деп атау келісілген. а-целлюлоза - бұл 200 ... одан да көп ... ... тұратын целлюлозаның бөлігі. Целлюлозаның осы бөлігінің ерекшелігі - бұл 17,5%-дық ... натр ... ... (бұл ... ... ... процесінің параметрлері).
Гемицеллюлоза және пектиндер. Техникалық целлюлозаның ерігіш түрін "гемицеллюлоза" деп атайды. Гемицеллюлоза 200-ден 50-ге дейін глюкоза қалдықтарынан ... ... және ең ... ... ... ... n 50-ден аз болатын y-фракциясынан тұрады. "Гемицеллюлоза" деген атау "а-целлюлоза" ... атау ... ... ... құрамына тек қана молекулалық массасы төмен болатын целлюлоза кірмейді, онымен қоса молекулалары ... ... мен ... ... ... полисахаридтер кіреді. Олардың ортақ қасиеті - n ... ... ... ... 200-ден кем, сол себепті 17,5%-дық күйдіргіш натр ерітіндісінде ... ... ... целлюлозамен бірге басқа да қосымша заттар кездеседі. Олардың бірі пектинді заттар мен пентозандар. Пектинді заттар - көмірсу классының ... ... ... ... ... ... келеді, бірақ урон қышқылы қалдықтарынан құралған, дәлірек айтқанда - ... ... ... ... ... ... ... деп аталса, оның метилді эфирлері - ... деп ... ... 5). ... 5 - ... макромолекуласының құрылымы
Пектинді заттар қышқылдарға тұрақты, дегенмен сілтіқоып ... ... өте тез ... ... Олардың бұл қасиеті целлюлозаны пектинді заттардан тазартқан кезде қолданылады.
Пентозандар - пентоза қалдықтарынан, негізінен, ... мен ... ... ... Сәйкесінше бұл пентозандар "арабандар" мен "ксиландар" деп аталады. Олардың құрылымы тізбекті немесе әлсіз тармақталған, өсімдіктердің құрамында олар пектинді заттармен қоса ... ... ... ... ... ... Арабандар суда жақсы еритін болса, ксиландар суда ерімейді.
Лигнин. Целлюлозаның келесі тағы бір серігі - лигнин, тармақталған полимер, ... ... ... ... осы полимер өсімдік клеткалары арасындағы кеңістікті бітеп тастайды да, ... ... ... ... ... ... талшықтарын бірге ұстап тұратын инкрустациялаушы зат сияқты ... ... ... көп ... ... ағашта кездеседі - 30% дейін. Өзінің ... ... ... ... ... ... осы полимер көпатомды фенолдардың туындысы, яғни майароматты қосылыстарға жатады. Оның целлюлозадан ең негізгі айырмашылығы - ... ... ... ... емес, яғни полимер молекуласын бірдей мономер қалдықтары емес, әртүрлі құрылымдық компоненттер құрастырады. Дегенмен ... да ... бір ... бар - олар ... ядро мен ... ... ... тұрады, барлық лигниндерге тән болып келетін осы құрылымдық элементті "фенилпропанды мүше" деп атайды.
Осылай лигнин жалпы формуласы ... ... ... ... ... тобына жатады. Лигнин тұрақты бір анықталған жеке құрамы мен құрылымы бар химиялық қосылысқа жатпайды. Лигниннің жоғары реакциялық қабілеттілігі және оның ... ... ... ... ... ... қатты бөгет жасайды, дегенмен барлық лигниндердің құрамына ... ... ... ... ... ... ... анықталған.
Әртүрлі өсімдікерден - біржылдық және ағаш ... - ... ... ... ... байқаған. Мысалы, шөптесін және астық тұқымдастарының лигнині ... ... ... ... ... ал ағаш ... - жақсы ерімейді. Осындай ерекшеліктер ағаш материалын лигниннен тазарту ... - ... ... ... ... ... мен қысымды жоғарылату салдарынан).
Лигнин жоғары реакциялық қасиетке ие, реакцияларға тез арада кірісіп кететін функционалды топтары көп ... ... ... химиялық өзгерістерге ұшырай алады. Әсіресе бұл бүйірлік пропан тізбегінде орналасқан көміртегі атомдарымен ... ... - ОН ... топтарына байланысты. Осы - ОН топтары бойынша делигнификация процессінің бір түрі - сульфитті қайнату ... ... ... ... [2]
1.3 Полиферментті целлюлазалық комплекс
Целлюлозаның ферментативті деструкциясы жеке-жеке ферменттермен емес, полиферментті комплекстермен жүзеге асырылады. ... ... ... ... және оларды құрайтын жеке ферменттердің көптүрлілігіне байланысты, сонымен қатар целлюлозаның өзінің құрылымының күрделі болуына және формаларының алуантүрлілігінің әсерінен ... ... ... әсер ету ... тек бір ... ... ... Дегенмен осы процесстің өте қарапайым түрде келесідей көрсетуге болады. Целлюлозаның гидролизі целлюлаздық полиферментті жүйелермен (комплекстермен) асырылады. Целлюлаздық комплекс төрт ... ... ... ... ... ... экзо-1,4-β-глюкозидаза және целлобиогидролаза (β- глюкозидаза). [9]
Целлюлолиткалық ферменттер О-гликозидтік байланыстын гидролизін катализдейтін карбогидразаларға жатады және табиғатта ең жиі ... ... ... бұл ... ... ... жоғарғы және төмен сатыдағы өсімдіктерде, микроорганизмдерде кездеседі. Целлюлазалық комплекстерге кіретін ферменттерге ерекше ... ... тән ... - ... ... ... ... В- целлюлоза молекуласының тотықсыздандыратын соңдары, К- субстраттың кристаллдық аймақтары, А - субстраттың аморфты аймақтары.
Сурет 6 - ... ... ... ... ... ... ... орта бөлігінде орналасқан моносахаридтердің арасындағы гликозидтік байланыстарды үзетін болса (оларды эндодеполимеразалар, эндоглюканазалар, эндоферменттер деп ... ... ... шет ... ... ... ... ажыратады (экзодеполимераза, экзоглюканаза, экзоферменттер). Глюкозидазалар ди- және олигосахаридтердің гликозидтік байланыстарын үзеді. Целлюлазды комплекстің құрамына ферменттердің 10-20 дейін ... кіре ... ... ... ... ... ... бөліктеріне (микродефекттеріне) әсер етіп, целлюлозадағы ішкі байланыстарды үзеді. Целлобиогидролазалар целлюлоза молекулаларының ұштарымен байланысып, соңынан ... ... ... ... ... ... көп ... целлюлозаның кристаллды бөліктеріне әсер етеді. Осы ферменттерді целлюлозаның терең гидролизіне ... ... ... ... ... деп ... болады. р-глюкозидазалар (целлобиазалар) целлобиоза және еритін целлоолигосахаридтердің молекулаларын соңғы өнімге - ... ... ... (6-сурет). [15]
1.4 Целлюлазалардың белсенділігіне әсер ететін факторлар
Целлюлазды комплекстердің қасиеттеріне әсер ... ... ... ... ... ... және ... жеке қасиеттерін және осы ферменттердің активтіліктерінің арақатынасын атап өту қажет. Ферменттердің индивидуалтды қасиеттеріне олардың целлюлозаға әсер ету механизмі және молекулярлық ... ... осы ... ... целлюлозаның қандай бөліктері және қандай жылдамдықпен ыдырайды), олардың целлюлоза бетінде адсорбциялану қабілеті, рН пен температура оптимумдары ... ... ... ... ... ... ... орташа температураларда, 40-50оС, және жоғарғы температураларда, 60-80оС, ... ... ... ... ... ... ... ), және белгілі бір қолданылу жағдайларына байланысты тұрақтылығы ... ... ... эндоглюканаза мен целлобиогидролаза, целлобиаза активтіліктерінің арақатынасы биообъектінің генетикалық қасиеттеріне - ... пен оны ... ... байланысты болады. Тағы бір маңызды құбылыс - бұл ... ... ... ... ... - яғни ... ... жұмыс жасағанда әсерлерінің күшейуі, үдеуі (әсіресе эндоглюканаза мен целлобиогидролаза арасындағы синергизм жиі орын алады). Эндоглюканазаның да, целлобиогидролазаның да ... ... ... ... формаларының толық деструкциясын жүргізуге қабілеттілігі жоқ екендігі белгілі, бірақ бірге осы екі фермент толық деструкцияны жүргізе алады. ... ... ... ... мен ... тағы бір атап ... ... - бұл олардың целлюлоза бетінде адсорбциялануға қабілеттілігі. Эндоглюканазалар мен целлобиогидролазалар адсорбциялық қасиеттері жағынан бір-бірінен он ... ... жүз есе ... ... ... ... алынған целлюлаза препараттары көрсеткендей, ферменттер целлюлозада неғұрлым мықты ... ... ... ... ... ... жүргізуге қабілеті артады. Зерттеулер көрсеткендей, целлюлазалардың адсорбциялық қасиеттері молекулаларында адсорбционды немесе целлюлоза байланыстырушы доменнің болуына байланысты.
Қазіргі зерттеулер бойынша, целлюлолитикалық ... ... - ... ең кем ... үш әртүрлі функциональды құрлымдық элементтері бар мультидоменді белоктар, бұл ... ... ... ... ... және ... ... линкер (сәйкесінше, КД және ЦБД) (Сурет 8). Ферменттердің ... ... ... ... (Сурет 7). Доменнің екі түрінің бар екендігі 70-жылдары көрсетілген болатын, целлюлозада жүргізілген аффиндік хроматография процессі кезінде кейбір саңырауқұлақтардың целлюлазалары ... ... ... ... ... берік адсорбцияланған қалпында ыдыратқан. Бұл олардың целлюлозамен байланысына жауапты бір бөліктің активті орталыққа кірмейтін жеке ... ... ... ... құрылымындағы осы үш негізгі фрагменттерімен қатар басқа да ... ... ... ... ... ... домен (КД), фибронектин ІІІ-тәрізді домендер, қайталанатын гидрофобты тізбектер, мысалы, когезин-докеин типті, т.б.
Осындай целлюлазалардың әсерінен болатын целлюлозаның деструкциясын келесідей қарастыруға ... ... ... ЦБД ... ерімейтін субстрат бетімен байланысады. ЦБД-мен қозғалмалы линкер арқылы байланысқан КД ашық ... ... ... ... механизм арқылы ыдыратады, сонымен қатар ферменттің ерітіндіге десорбциясы да орын алмайды.
Сурет 7 - ... lividans β-1,4- ... ... ... 8 - T. fusca ... моделі
ЦБД-сы болмайтын целлюлазалар да кездеседі. Осы ферменттердің ... ... өте ... ... әсер ... олар бір немесе бірнеше каталитикалық акт өткізеді де, кейін ферменттер ... ... ... ... ... Қалыпты жағдайларда осындай целлюлазалар кристаллдық целлюлозаны ыдырата алмай, тек ... ... бар, ... ... ғана әсер ете ... Жоғары көрсетілген целлюлозаның ферментативті деструкциясының заңдылықтары, негізінен, саңырауқұлақ микроорганизмдері бөлетін полиферментті целлюлазды комплекстерге тән, ... ... ... ... ... ... ... масштабта шығарылады да, қолжетімді коммерциялық препарат болып табылады. Бактериальды целлюлолтиткалық ферменттердің үлкен ... ... ... олар кең ... ие болмаған, себебі бактериялардың целлюлазаларды түзу қарқындылығы саңырауқұлақтармен салыстырғанда өте төмен. Дегенмен бактериальда целлюлазаларды зерттеу жұмыстары жақсы жүргізілуде. Бактериальды целлюлазалардың бір ... - бұл ... ... ... ... деп ... үлкен агрегаттарға жинақталған. [11]
1.6 Эндоглюканазалар
Полиферментті целлюлазалық комплекстің ішінде эндоглюканазалардың орны ерекше, ... тек осы ... ... ... ең бірінші болып ыдырататуға кіріседі.
Эндоглюканазаның ыдырататын байланыстары - полисахарид тізбегінің ортаңғы бөлігінде орналасқан 1,4-β-гликозидтік байланыстар, дисахаридтерді ыдырата ... ... ... байланыспен кезектесіп орналасқан 1,3- және 1,6-гликозидтік байланыстарды да үзе алады. Эндоглюканазалардың активтілігінен кейін субстраттағы полисахаридтердің полимеризациялану ... күрт ... ... ... ... ... ретінде моно-, ди-, трисахаридтер бола алады.
Әртүрлі организмдерден алынған эндоглюканазалардың молекулалық массасы орта ... 30-70 кДа тең, ... ... молекулалық массасы одан жоғары (90-100 кДа) немесе кіші (5-20 кДа) эндоферменттер кездеседі. Эндоглюканазалар көп жағдайда бір полипептидтік тізбектен тұратын ... ... ... екі ... ... өте сирек кездесетін жағдай, мысалы, Sclerotium rolfsii эндоглюканаза ферменті 22 және 32 кДа болатын екі суббірліктен құралған.
Эндоглюканазалардың ... ... ... ... ... қант ... ... үлесі өте өзгермелі - өте аз мөлшерден 50%-ға ... ... ... ... ... ... галактоза, ксилоза, N-ацетилглюкозамин және N-ацетилгалактозамин кіреді.
рН-оптимумы - 4,0- 5,5. Эндглюканазалардың изоэлектрлік нүктелері, негізінен, қышқыл (рН 3-5) ... ... ... жақын (рН 6-8) көрсеткіштерде жатады.
Целлюлазалық комплекстің басқа компоненттері сияқты эндоглюканазалардың арасында да бір-бірінен молекулалық массасы, көмірсу тізбегінің құрамымен, изоэлектрлік ... ... және ... ... мен ... ... ... формалары бар. Бұл құбылыстың себептері мен ролі әлі нақты ... ... бір ... ... ... пен ... жалғануынан болатын модификация мен толық емес протеолизге байланысты. Егер ... ... жоқ ... ... онда оған себеп ретінде посттрансляциялық модификация - гликозилдену ... ... Бұл ... тың ... ... ... да ... болады. Осы жағдайда ферменттің изоформалары туралы зерттеулер жүргізілуде.
Эндоглюканазалардың каталитикалық активтілігіне олигосахаридтегі моносахарид қалдықтарының саны әсерін тигізеді. Олигосахарид тізбегі ... ... ... ... ... ... активтілігі жоғарылайды. Бұл көрсеткіштерге сәйкес эндоглюканаза ферменті активті орталығының көпсайтты құрылымының гипотезасы жасалған. Яғни ... ... ... ... саны ... көп болса, ферменттің активті сайттары субстратпен жақсы байланысып, реакция жылдамдығы артады.
Целлюлозаның ферментативті гидролизі кезінде эндоглюканаза аса маңызды роль ... осы ... ... және ... оны өндірісте пайдалану өте қажетті болып келеді.
2 ЗЕРТТЕУ МАТЕРИАЛДАРЫ МЕН ЗЕРТТЕУ ӘДІСТЕРІ
2.1 Материалдар
Жұмыс барысында Aspergillus niger ... ... ... ... ... Рецепиент клетка штамдары
Рекомбинантты ДНҚ молекуласын көбейту үшін Escherichia coli клеткасының JM109 (endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB+ ... e14- [F' traD36 proAB+ lacIq ... ... ... және ... ... экспрессиясын талдау үшін Rosetta (DE3) (F-ompT hДСНB(rB-mB-)gal dcm(DE3) pRARE (CamR)) экспрессиялық штаммы қолданылады.
2.2 Зерттеу әдістері
2.2.1 Aspergillus niger саңырауқұлағы ... ... ... қышқылы препараттарын бөліп алу
Нуклеин қышқылы препараттарын бөліп алу үшін материал Aspergillus niger саңырауқұлағының мицелиін қолданамыз. Мицелийді ағаш ... ... ... бірнеше қайтара физиологиялық ерітіндіде жуу қажет.
Aspergillus niger саңырауқұлағының мицелийін сұйық азотта, фарфор келіде ұнтақтаймыз. Алынған ұнтаққа алдын ала ... 1-2мл ... ... ... 100мМ ... (pH 8,0), 25мМ ... 2М NaCl, 0,2% ... 0.2% pVp40000 қосып, гомогенизациялаймыз. Гомогенатты эппендорф пробиркаларына ... 10 ... 65о С ... инкубациялу қажет. Инкубация уақыты аяқталғаннан кейін экстрактке тең көлемде айдалған хлороформ ... ... ... 15 ... ... кейін 10 минут 12000 g/мин жылдамдықта центрифугалаймыз. Кейін беткі сулы фазаны жаңа эппендорф пробиркаларына ауыстырып, 2,5 көлемде алдын ала ... ... ... ... араластырып, 30минут бойы мұзда инкубациялаймыз. Инкубация уақыты аяқталғаннан кейін 15 минут бойы 14000 g/мин ... ... ... ... ... нуклеин қышқылы бар тұнбаны ауада кептіріп, 50мкл деионизделген суда ерітеміз. Нуклеин қышқылдарының концентрациясын 260нм толқын ... ... ... өлшейміз.
Нуклеин қышқылдарының тотальді препараттарынан РНҚ-ны 9 М LiCl - да 30 минут бойында 0 °С температурада ... ... ... ... ... Кейін тұнба мен супернатантты -70 °С температурада 2,5 көлемдегі спиртпен периципиттацилаймыз. ... ... ... ... ... ...
Бөлініп алынған тотальдік нуклеин қышқылының сапасын 1% агароза гелінде трис-бораттық буферлік (ТBE - 45 mM ... 1 mM EDTA, pH 8.0) ... ... ... ... ... ... бромды этидиймен бояп, ультрофиолет жарығында суретке түсіреміз.
2.2.3 мРНҚ бөліп алу
мРНҚ-ны байыту үшін Poly(A)Purist(TM) MAG Kit (Ambion Cat. No. 1922) ... ... ... ... (600 ... РНҚ ... тең ... 2Х Binding Solution қосып, араластырамыз.
Магниттік бөлшектерді байыту реакциясына дейін тазартып аламыз. 100мкг тотальдік РНҚ-ға ... (10 мкл) ... МВ алу ... ... талап етілген мөлшерін пробиркаға ауыстырып, пробиркаларды магниттік штативке магнит төңірегінде жинақталуына ... ... ( ... 2-3 ... қоямыз. МВ жинақталғанда, абайлықпен буферді пробиркадан аластатамыз. Тұтылған МВ - ге Wash Solution 1 (1мг ... ... ... ... ... пробиркаларды штативтен шығарып, магниттік бөлшектерді қоспада ресуспендиялап, қайтадан штативке орналастырамыз. ... ... ... абайлап супернатантты пробиркадан аластатамыз. Жуу процессін екі қайтара қайталаймыз. Тазартылған ... ... ... реакциясында қолданамыз. Ол үшін 1Х Binding Solution-де ресуспендияланған РНҚ қоспасын жуылған магнит ұнтақтары бар пробирқаға ... ... ... ... 5 ... 65-75°С температурада қыздырып, кейін 30-60 минут бойында бөлме температурасында шайқағышта инкубациялаймыз.
Инкубация уақыты аяқталғаннан ... ... ... ... орналастырып, суперді аластатамыз. Тұтылған бөлшектерді Wash Solution 1 (РНҚ-ның 2Х Binding Solution қосқанға дейінгі көлеміне тең ... екі ... ... ... ... жолмен МВ ұнтақтарын Wash Solution 2 мен екі қайтара жуамыз. Жуылған ... ... бар ... штативтен шығарып, МВ үстінен 200 мкл жылытылған (60-80°С) the RNA Storage Solution ... ... ... штатив көмегімен МВ - ні тұтып алып, элюирленген мРНК-ны жаңа пробиркаға ауыстырамыз. поли-А ... ... үшін ... 40 мкл 5М ... ацетатын, 1 мкл гликоген (optional), 1.1 мл 100% этанол ... 30 ... -70°С ... ... ... уақыты аяқталғаннан кейін 20-30минут 12000 g/мин жылдамдықта центрифугалап, 1мл 70% этанолда ... ... ... the RNA Storage ... ... олиго-dT MagBeads' те байытылған мРНҚ сапасын % агароза гелінде трис-бораттық буферлік жүйеде электрофорез жүргізу арқылы анықтаймыз.
2.2.4 Кері ... ... ... транскрипция реакциясы РНК-тәуелді ДНК-полимераза (М-МuLV-RT,фирмы ) көмегімен жүргіземіз.
ДНК синтездеу үшін ... ... ... ... РНҚ (10 нг - 5 мкг ... РНҚ немесе 1 - 500 нг поли-А РНҚ), кері праймер (10-15 пмоль ген-спецификалық праймер), ... dH2O 11мкл ... ... ... қоспаны 5 минут 70oС-та екінші құрылымдық деңгейін ширату үшін қыздырамыз. Кейін мұзда суытылған қоспаның үстінен (көрсетілген ретпен): 4 мкл 5Х ... ... (250mM Tris-HCl pH 8.3 при 25°C, 250mM KCl, 20mM MgCl2, 50mM DTT), 0.5 мкл (20 u) ... RNase ... 2 мкл 10mM dNTP ... 1 мкл (200 u) RevertAid(TM) H Minus M-MuLV Reverse Transcriptase ... 1,5 мкл dH2O ... ... 5 ... 37°С ... ... 90 ... 42°С температурасында инкубациялаймыз. Реакцияны 70°С-та 10минут қыздыру арқылы терминациялаймыз. Алынған өнімді -20°С мұздатқышта сақтаймыз.
2.2.5 Полимераздық тізбектік реакция (ПТР)
Аналитикалық процедуралар үшін ... ... ... препаративті процедуралар үшін Pwo--полимераза (Roche Cat. No. ... ... ... ... үшін ... тізбектік реакцияны (ПТР) жүргіземіз.
20 мкл көлеміндегі реакциялық қоспа: 1мкл КТР, 2 мкл 10Х Reaction Buffer ... 4 мкл 25 мМ MgCl2, 0,5 мкл dNTP(10 мМ), ... bsa ... ... ... 1 ... 0,5 мкл Taq(Pwo)-полимераза (5 б/мкл, фирма ), 1 мкл-ден тура және кері праймер (10 ... 8,5 мкл d ... ... ... ... температуралық режимде жүргіземіз.
1 кезең - 94С 1 мин - 1 ...
2 ... - 94С 1 мин, 61С 30 сек, 72С 30 сек - 30 ...
3 ... - 72С 2 мин - 1 ... 4С 10 мин.
ПТР өнімдерін 1 % агарозалық гелде талдаймыз.
2.2.6 ... ... ... ... ... ... ... алу үшін Agarose Gel DNA Extraction Kit (Roche Cat. No. 11696505001) қолданылады.
Нуклеин қышқылдарын агароза гелінде бөлгеннен кейін, ... ... ... ... ДНҚ ... өткір скальпель көмегімен, ультрафиолет жарығы астында кесіп аламыз. 100мг агарозалық гелге 300мкл солюбилизациялаушы буфер (Solubilization Buffer), 10мкл ... ... ... (Silica matrix ) ... 10 ... 56-60º С су моншасында әр 2-3 минут сайын ... тұру ... ... ... ... 13 000 g/мин. жылдамдықпен 1 минут центрифугалап, супернатантты аластатып, ДНҚ-лы матрицаны 500мкл нуклеин қышқылын байланыстырушы ... (Binding buffer) ... 1 ... 13 000 ... ... центрифугалаймыз.
Супернатантты төгіп, тұнбаны екі қайтара 500мкл 70% ... (Washing Buffer) ... ... араластырғаннан кейін 13 000 g/мин. жылдамдықпен 1 минут центрифугалап, супернатантты төгіп, алынған тұнбаны 15 минут термостатта (37ºС) ... ... ... ... ... су (рН 8.0 - 8.5) ... 5 минут 55-60ºС - та әр2-3 ... ... ... ... ... ... ... 13 000 g/мин. жылдамдықпен 1 минут центрифугалап, элюцияланған ДНҚ-ны матриксті іліп алмай жаңа пробиркаға ауыстырамыз.
2.2.7 Вектор мен зерттелетін ДНҚ ... ... ДНҚ ... мен ... ... ... рЕТ-11d экспрессиялық векторын XbaІ және BamHI ферменттерінің ... ... ... өңдейміз (1-кесте).
Компоненттерді араластырып, 1-4 сағат бойы ферменттердің жұмыс жасауы үшін оптимальді температурада (XbaІ және BamHI -37 ... ... ... ... 1 - ... ... ... рестрикциялық буфер
2 мкл
1 мг/мл БСА
2 мкл
ДНҚ(~1 мкг)
1 мкл
Рестриктаза 1 (10 u)
1 ... 2 (10 u)
1 ... ... ... мкл
2.2.8 Вектор мен ДНҚ фрагментін тігу
Плазмидалық векторға Aspergillus niger саңырауқұлағының eng1 ... ДНҚ ... Т4 ... ... (Fermentas #EL0015) ферменті көмегімен тігеміз. Реакцияның эффективті жүруі үшін ұсынылатын ... ... ... ... - 1:1, 1:3 ... 3:1. ... 2-кестеде 3.0 kbp-вектор мен 0.5 kbp-ендірменің 1:3 қатынасындағы лигазалық қоспаның құрамы көрсетілген (2-кесте).
Кесте 2 - ... ... ... ... лигазалық буфер
1 мкл
Векторлық ДНҚ
100 нг
Ендірілетін ДНҚ фрагменті
50 нг
Т4 ДНК-лигаза (3u/мкл)
1 мкл
dH2O
10 мкл ... ... ... соңдардың тігілуі үшін 3 сағат 22 - 25°С-та, немесе 12сағат 4°С-та, ал доғал ұштарының тігілуі үшін 18 ... 15°С - та ... ... ... coli клеткаларын дайындау
Компетентті клеткаларды алу үшін бактериальды клеткалардың ... ... ... ... ... LB ... ... Бір түннен кейін агарлы LB ортасында өсіп шыққан жеке колонияны 10мл ... (10г ...... ... 10г NaCl, рН 7,0) ... де, 37°С қатты аэрациямен (200 айн/мин шейкерде) бір түн ішінде инкубацияға қоямыз. Түнгі культураның 1мл-ін LB ... ... ... 37°С ... аэрация жағдайында 2-4 сағ оптикалық тығыздығы ОD600~0,4 (~108 клетка/мл) жеткенге дейін өсіреміз. Культураны жаңа ... ... ... ... 10 мин ... ұстаймыз. Ары қарай клеткаларды жинақтау үшін пробиркаларды 5000 ... 5 мин 4 °С ... ...
Химиокомпетентті клеткаларды дайындау үшін клеткалық тұнбаны 50-80 мл салқын ТВ-буферінде сұйылтамыз Pipes-NaOH pH 6.7, 15мМ CaCl2, 0.25мМ KCl, 55мМ MnCl2) да, 10 мин ... ... ... ... 10 мин ... 5000 айн/мин 4°С центрифугалаймыз. Клеткалық тұнбаны 20мл салқын ТВ буферіне сұйылтып, 1,5мл DMSO қосамыз да, 10 мин ... ... ... ... ... -80°С ... сақтаймыз.
Электрокомпетентті Escherichia coli клеткаларын алу үшін центрифуга арқылы жиналған клеткаларды 200мл ... ... ... ... да, кейін 10%-дық стерильді глицерин ерітіндісінде жуамыз. ... ... ... ... ... үстінгі фазаны төгіп тастаймыз. Клеткалардың тұнбасын 3мл 10% глицерин ерітіндісінде сұйылтамыз. Суспензияны 200мкл аликвоталарға бөліп, ... азот ... ... ... ... клеткаларды -80°С сақтау қажет.
2.2.10 Трансформация
Лигирование реакциясының өнімдерін E. coli клеткаларын трансформациялау үшін ... ... ... ... үшін ... ... мұз ... ерітіп, 100-150мкл клеткаға 10-15 мкл лигирование өнімін қосып, ... 25-40 ... ... Инкубацияланған қоспаны 90 секунд 42 ºС - та қыздырып ( жылулық шок), 3 минут мұзда ұстаймыз (поралары жабылуы үшін). ... ... 4 есе ... ... LB - ортасын құйып, 37ºС - та 30-60 минут щайқап, инкубациялау керек.
Трансформацияланған ... ... ... ... ... ... LB - ортасында жүргіземіз.
2.2.11 ДНҚ мини-препараттарын сілтілі гидролиз әдісімен бөлу
Ампициллин қосылған агарлы ортада өсіп ... ... ... ... LB - ... 37º С-да 12 ... бойы өсіреміз.
Түндік культураларды микробиологиялық пробиркалардан эппендорф пробиркасына ауыстырып,2 минут 13000 g/мин. жылдамдықпен центрифугалаймыз. ... ... ... тұнбаға түскен клеткаларды 100мкл №1-ерітіндіде (50mM глюкозы, 25mM Tris-HCl (pH 8.0), 10mM EDTA (pH 8.0) ресуспендиялап,5 миут бөлме ... ... ... ... ... 200мкл жаңа дайындалған №2-ерітіндіні (0.2N NaOH, 1% SDS) ... ... ... арқылы араластырып, мұзда 10минут инкубациялаймыз. Инкубация уақыты аяқталғаннан кейін мұздатылған 150 мкл №3-ерітіндіні (100 мл: 60 мл 5М ... ... 11.5 мл ЛУК, 28.5 мл H2O) ... араластырып, мұзда 10 минут инкубациялаймыз. Кейін қоспаның үстінен тең көлемде айдалған хлороформ қосып, жақсылап ... ... ... ... ... ... ... 5 минут 13000 g/мин. жылдамдықпен 4оС температурада мұздатылатын центрифугада центрифугалаймыз. Беткі сулы фазасын жаңа эппендорфқа ауыстырып, (-20 оС) ... ... 6/10 ... ... ... ... минут бөлме температурасында инкубациялаймыз.
Инкубация уақыты аяқталғаннан кейін 10 минут 13000 g/мин. жылдамдықпен центрифугалау қажет. ... ... ... 70% ... ... кептіріп, 50 мкл деионизделген суда ерітеміз.
Алынған плазмидаларды 2.2.7.2.бөімінде көрсетілген әдіспен рестрикциядан өткізіп, ендірменің бар/жоғын гель-электрофорез көмегімен анықтаймыз.
2. 2.12 ... ... ... (DE3) ... жеке ... ... (100 мкг/мл) және хлорамфеникол (34 мкг/мл) қосылған 1,5 мл ... ... ... ... (220 - 250 g ... 37°С температурада 12 сағат бойы өсірдік.
Әр ... 500 ... ... (100 ... ... 1,5 мл жаңа ... LB - ортасына ауыстырып, гендердің экспрессиялануын 1мМ ИПТГ концентрациясында, бөлме температурасында 7 сағат бойы инкубациялау ... ... ... ... ... ... ... алдық.
2.2.13 Экспрессияланған белок препаратын дайындау
Инкубация уақыты аяқталғаннан кейін ... 5 ... 13000 ... ... центрифугалап, тұнбаға түскен клеткалардың (индукцияланған және бақылау) салмағын ...... ...... ... ( 0,12 М ... (рН 6,8), 2% SDS, 20% ... 10% меркаптоэтанол, 0,06 % бромфенолды көк) ресуспендиялап, 5 минут 85°С температурада қыздырдық. Кейін 10 минут 13000 g/мин. жылдамдықпен 4оС ... ... ... ... ... ... ... (ДСН) пайдаланып, полиакриламид гелінде сұрыптау үшін үлгі ... ... ... ... (ДСН) пайдаланып, полиакриламид гелінде сұрыптау
ДСН-ПААГ электрофорезі белоктарды тек бір ғана параметрі бойынша сұрыптауға мүмкіндік ... Ол үшін ... бар ... көп ... ДСН - ... ... ... додецилсульфат-белоктармен берік байланысып, денатурациялайтын теріс зарядты детерегент. Ерітіндідегі тұрақты белок/детерегент қатынасы, қандайда ... ... ... ... ... ... жасайды /6/.
ДСН-ПААГ электрофорезін жүзеге асыру үшін мынадай ерітінділер құрамы қажет: құрамында 0,8%-ті метиленбисакриламид бар 30%-ті ... ... ДСН ... бар 1,5М ... ... ; 10%-ті ... ... ТЕМЕД; құрамында, 125М трис-НС1 (рН 6,8), глицерин, 10%-ті меркаптоэтанол, 0,006 %-ті көгілдір бромфенолдан тұратын ... ... және 14 г ... 3 г ... және 1 г ДСН ... ... рН 8,3 ... буфер. Сұрыптаушы гель компаненттерін қажет концентрациясына қарай араластырып, оны ... ... өз ... 12%-ті ... ... пайдаландық. Оның құрамы 2мл 30%-ті акриламид, 1,25 мл 1,5М ... ... 50мкл 10%-ті ДСН. Осы ... ... 15мкл ... ... ғана дайындалған 10%-ті амоний персульфатын және 8мкл ТЕМЕД қосып, гельдің ... ... ... ... ... шамамен 2 см ауданын бос қалдырып, ерітіндімен толтырамыз. Содан соң гельдің біркелкі тегіс болуы үшін оның ... 3 мм ... ... бутанол ерітіндісін баяу енгіземіз. Полимеризация уақыты аяқталған соң, камераны бутанол ерітіндісінен аластап, оған концентрациялаушы гель компаненттерін қостық. Оның ... 0,3 мл 30%-ті ... 0,5 мл 10%-ті ДСН бар 0,2М ... (рН 6,8); 1,1 мл дистилденген су ; 15 мкл 10%-ті персульфат ... және 8 мкл ... ... ... оған 1 мм ... ... ... концентрациялаушы гельдің полимеризациялануын күтеміз.Полимеризация біткеннен соң, камерадан тарақшаны алып,оның орнында пайда болған қалташаларды дистилденген сумен жуып, ... ... ... ... ... ... толтырдық. Электродтық буфердің құрамы: 0.4%-ті ДСН бар рН 8,3 трис-глицин буфері.
Одан кейін гельдегі қалташаға 10мкг белокты енгізіп, электрофорезді 3,5сағат бойы анод ... ... 100В ток ... іске ... Электрофорез аяқталған соң, ажыраған белок аймақтары диффузия арқылы бір-бірімен араласып кетпеуі үшін ... 1 ... 10 %-ті ... ... ... ... уақытынан соң гельді 3,5%-ті НС1О4 ерітіндісінде дайындалған 0,04%-ті кумасси G-250 бояуымен бояп, 7,5%-ті ... ... ... шайқаймыз, нәтижесінде белоктар ақшыл түсті гельде көк жолақ түрінде айқындалады.
2.2.15 Фермент белсенділігін анықтау ... ... ... ... ... ... және ... қағазын субстрат ретінде қолданғанда көрсететін белсенділігін тотықсыздандырғыш қанттардың түзілу жылдамдығын (ферментативті реакцияның 1 сағатында) бақылау арқылы Шомоди-Нельсон әдісімен ... ... ... ... ... ... ... ферменттің жұмыс істеу рН-оптимумында, оптимальды температурада және субстрат концентрациясы 10 г/л болғанда минутына 1 мкМ тотықсыздандырғыш қанттардың түзілуін қамтамасыз ... ... ... алынған.
Сынамалардағы белоктың мөлшерін Бредфорд әдісі арқылы анықтадық, стандарт ретінде бұқаның сарысу альбумині қолданылды (БСА). ... ... үшін ... PD-303UV ... ... ... ... белсенділігін Шомоди-Нельсон бойынша анықтау
Шомоди ерітіндісін және ерітінділерін қосу арқылы дайындадық. ерітіндісі 250 мл дистиллденген суға 24г ... Na2CO3 және 12г ... ... кислый қосу арқылы жасалынды. Қоспаны тұздар толық ерігенге дейін ... ... ... жағдайында CuSO4 * 5H2O қостық (4г 40 мл-ге). Дайындалған ерітіндіге 16г натрий ... ... ... ... ... 18г натрий сульфатын 500 мл суда ерітіп (80оС), 5 мин қайнаттық. Ары қарай және ерітінділерін бір-біріне ... ... 1000 ... ... ... ... жеткіздік. Нельсон ерітіндісін 25г аммоний молибдатын 450 мл дистиллденген суға (60оС) қосу ... ... ... 10оС ... оған ...... арсенаты бар 98%-дық 21мл күкірт қышқылы қосылды. Алынғын ерітіндіні 40оС температурада тәулік бойы ұстап, әр ... ... ... өткізіп отырдық.
Эндоглюканазалардың белсенділігін анықтау үшін 0,5мл фермент ерітіндісінен және 1 мл Na-цитрат ... ... ... ... су ... 50оС ... ұстадық. Ферменттік анализ үшін субстрат ретінде соңғы концентрациясы 1% болатын карбоксиметилцеллюлоза қолданылды. Қоспадан 0,5 мл ... ... ... термотұрақты пробиркада 0,5 мл Шомоди реагентімен қосылып, 15 мин қайнатылды. Кейін сынаманы бөлме температурасына дейін суытып, Нельсон ... 0,5 мл ... ... ... 5 ... дейін дистиллденген сумен жеткізіп, жақсылап араластырғаннан кейін 540нм толқын ұзындығында спектрофотометрмен ерітіндінің жарық толқынын жұту ... ... ... ... ... ... ... калибровты графиктің көмегімен әрбір ферменттік сынамада түзілген глюкоза мөлшерін анықтадық.
2.2.17 Фермент белсенділігінің рН пен температураға тәуелділігін зерттеу
Ферменттердің рН-оптимумын рН ... 4-тен 9-ға ... ... ... белсенділігін өлшеу арқылы зерттедік. рН-тәуелділігін зерттеу мақсатында келесі ерітінділер қолданылды: натрий ацетат буфері pH 4-6, натрий фосфат буфері pH 7-8 және ... ... pH 9. ... ... температураға тәуелділігін зерттеу үшін температураның 25-80оС диапазонында оптимальды рН жағдайында фермент белсенділігін анықтау арқылы жүргізілді.
Субстрат ретінде КМЦ ...
3 ... ... ЖӘНЕ ... ... Aspergillus niger IFO31125 саңырауқұлағының эндоглюконаза ферментін кодтайтын eng1 генін прокариот жүйесінде клондау
3.1.1 ENG1 эндоглюканазасының мРНҚ және ... ... ... ... ENG1 эндоглюконазаны кодтайтын eng1 генінің 1303 жұп нуклеотидтен тұратын кДНҚ-сының (GenBank ... ... ... ... қатарының компьютерлік анализін жасадық, ENG1 эндоглюконаза - бұл ... 332 ... ... ... 36,7 кДа және ... нүктесі (ИЭН) шамамен 4,1 болатын белок. Компьютерлік анализ деректері бойынша, бұл ... ... ... ... ... себебі оның N - соңында Arg28 бен Ala29 аминқышқылдарының арасында үзілетін сигналды пептид орналасқан. Еng1 генімен кодталатын белоктың ... Arg-76, His-120, Asn-159, Glu-160, His-225, Tyr-227 және Glu-267 ... 7 ... ... ... орналасқан, бұл осы белокты 5А гликозил-гидролазалар тобына жатқызуға мүмкіндік береді (9-сурет).
1
gtcacgcATGAAGTTTСAGAGCACTCTGCTTCTTGCCGCCGCCGGTGGTTCCGCGTTGGCTGTGCCTCATGGTCCTGGACATAAGAAG
M K F Q S T L L L A A A G G S A L A V P H G P G H K K ... ↑A S V F E W F G S N E S G A E F G T N I P G V W G T D Y I ... P D P S A I S T L I D K G M N F F R V Q F M M E R L L P D ... M T G S Y D E E Y L A N L T T V I K A V T D G G A H A L V ... P H N Y G R Y N G E I I S S T S D F Q T F W E N L A G Q Y ... D N D L V M F D T N N E Y H D M D Q D L V L N L N Q A A I ... G I R A A G A T S Q Y I F V E G N S W T G A W T W V D V N ... N M K N L T D P E D K I V Y E M H Q Y L D S D G S G T S E ... C V S E T I G K E R V T E A T Q W L K D N K K V G F I G E ... A G G S N D V C R S A V S G M L E Y M A N N T D V W K G A ... W W A A G P W W G D Y I F S L E P P D G T A Y T G M L D I ... E A Y L #
332
1081
tacagagaggagtactagtatacattagtggcagcgcactgactgacgtcacaaggcattccattctggacgctccatccttgtgcattc
1171
tgttgagtgttacctgtaggcactaggcagtaggcacgcctgtcgctgaaatagtgcacgttgtactccataacgagtagtcggtggatt
1261
cttatcaacgatcatcgagtaaaaaaaaaaaaaaaaaaaaaaaa
# - стоп - ... ... ↑- ... ... ... сайтын көрсетеді.
Сурет 9 - ENG1 эндоглюконазаның нуклеотидтік және аминқышқылдық тізбегі.
Aspergillus niger саңырауқұлағының eng1 генінің мРНҚ ... ... ... ... талдау арқылы генді кері транскрипция реакциясы (КТР) және ... ... ... (ПТР) ... ... ... үшін ... праймерлер есептеліп, синтезделіп алынды. Синтезделген олигонуклеотидтік праймерлердің нуклеотидтік реті ...
Dir 5'- ...
Rev 5'- ... сызылған нуклеотидтер сәйкесінше XbaI және BamHI рестрикция сайттары болып ... ... pET11d ... Т7 ... ... ... ENG1 эндоглюконазаның кДНҚ-сын амплификациялау және клондау
Біз жұмыс барысында Aspergillus niger саңырауқұлағы мицелиінен нуклеин қышқылы препаратын бөліп алдық. ... ... ... алу процессін бөлімінде көрсетілген әдіс бойынша жүргіздік. ... ... 1-тік ... гелінде электрофорез қою арқылы тексердік. Тотальды нуклеин қышқылы препаратының негізгі компоненттері 28S және 18S рибосомалық РНҚ, сонымен қатар,транспорттық РНҚ (4S, ... 100 ... ... ... РНҚ препаратын қосымша түрде 3М LiCl - мен тұнбаға түсіру арқылы тазалағанда, төмен молекулалы тРНҚ супернатантта қалып, препарат азды-көпті ... ... ... ... РНҚ ... 1 - ... ... түсірілген РНҚ, 2 - 3 - ... ... ... РНҚ. Оң ... 28S рРНК, 18S рРНҚ және тРНҚ (4 S) орналасуы көрсетілген.
Сурет 10 - ... niger ... ... ... ... қышқылының тотальдік препараты.
Бұл препарат КТ-ПТР әдісі көмегімен eng1 ... ... ... ... тотальді РНҚ препараты негізінде кДНҚ синтездеу іске аспағандықтан, мРНҚ-ның олиго-dT целлюлозада poli-A байытып, кері ... ... (КТР) ... ... eng1 ... кДНҚ молекуласын синтездедік және КТР өнімін полимеразды тізбектік реакция (ПТР) әдісі арқылы амплификацияладық. (Сурет 11)
М - ... 1-2 - ... кДНҚ ... 11 - кДНҚ ... ... суреттен расында да мөлшері шамамен 1000 ж.н. тұратын eng1 ... ... ... ДНҚ ... ... ... ... Клондалған гендердің экспрессиясын оптимизациялау үшін рекомбинантты ДНҚ-конструкциясының кассетасын жасау
Келесі ... ... ... ... ... үшін pET11d (Clontech) векторы таңдап алынды, бұл вектордың ген экспрессиясын тиімді жүргізу үшін келесі белгілері бар: Т7 ... ... ... lac промоторы, қажетті генді енгізу үшін сыйымдылығының үлкен болуы, селекцияны оңай жүргізу мүмкіншілігі. КТ-ПТР өнімін геннің екі ... ... ... бойынша XbaI және BamHI рестриктазаларымен өңдеп, оны осы рестриктазалармен өңделген pET11d плазмидасына ... ... ... ... ... жасалынды (сурет-12).
Сурет 12 - Рекомбинантты pET11d/eng1 конструкциясы
Рекомбинантты ... ... ... үшін ... векторды E.coli-дің JM109 штаммына трансформацияладық. Клондардың селекциясы ампициллин қосылған (200мкг/мл) агарланған LB ортасында жүргізілді. Алынған рекомбинантты ... ... үшін әр ... конструкцияның кемінде он клоны зерттелінді. High Pure Plasmid ... Kit ... ... ... алынған плазмидалық ДНҚ клондардың құрамында рекомбинантты плазмидалардың бар-жоғына тексеру үшін ПТР әдісінде ген ... ... ... ... ... ... амплификация өнімдері 1% агарозды гельде тексерілді. Агарозды гель-электрофорез арқылы анықталған ДНҚ фрагментері ұзындығы бойынша клондалған eng1 геніне сәкес ... бұл ... ... ... ... гені бар ... болуын дәлелдейді (13-сурет).
М - маркерлік ДНҚ фрагменттері; 1-5 - клондар.
Сурет 13 - ... ... ... ... анализіне қосымша түрінде рекомбинантты плазмидаларды рестрикциялық сайттары белок ... ... тыс ... (XbaI және BamHI) ... ... ... талдадық (14-сурет). ДНҚ гидролизінің өнімдері агарозалық гелде электрофорез әдісімен талданды. Рестрикциялық анализ ... ... ... - ... ДНҚ ... 1-5 - ... 14 - ... плазмиданың рестрикциялық анализі
14-суреттен рекомбинантты плазмидаларды XbaI және BamHI эндонуклеазаларымен рестрикциялағанда қажетті ұзындықтағы ДНҚ фрагменттерінің кесілетіндігін ... ... ... ұзындығы шамамен 5700 ж.н. - pET11d ... 1000 ж.н - eng1 ... ... ... ... нәтижелер, расында да біздің Aspergillus niger саңырауқұлағының ... ... ... ... ... ... ... плазмидалары бар 5 колония анықталды. Клондар екі бағытта да секвенирленген. Анықталған нуклеотидті тізбек осыған дейін жарияланған A.niger eng1 ... ... ... ... ... ... ... келді. [1]
Трансляцияланған нуклеотидті тізбек негізінде зерттелініп жатқан ENG1 белогына гомологты болатын белоктарды іздестіру жұмыстары NCBI ... BLAST ... ... клондалған эндоглюканазаның кДНҚ-сы гликозид-гидролазалардың 5А туысына жататынын көрсетті. Біріншілік құрылымы анықталған ферменттерді зерттеу барысында ... ... ... тізбегін салыстыру арқылы табылған ENG1 гомологтары 3-кестеде келтірілген (Кесте 3).
Кесте 3 - A.niger ... eng1 ... blastp ... ... ... және ...
(%)
Q96WQ8
Endo-beta-1,4-glucanase B
Aspergillus kawachii
626
0.0
99%
XP_001257866.1
Cellulase
Neosartorya fischeri NRRL 181
491
6e-170
80%
AAL88714.2
Endo-beta-1,4-glucanase
Thermoascus aurantiacus
446
6e-151
74%
AAL33630.2
Endoglucanase
Talaromyces emersonii ... ... ... ... клондалған eng1 генінің нуклеотидтік тізбегінің негізінде трансляцияланған аминқышқылдық тізбегі 5А гликозид-гидролазаларға ... ... ... ... ... ... ... көрсетеді.
3.2 ENG1 рекомбинантты эндоглюканазаның E.сoli Rosetta(DE3) штаммындағы экспрессиясы
Клондалған eng1 нуклеотидтік тізбегінің негізінде ... ... ... ... ENG1 белоктарына гомологты болса да, осы гендердің шынымен де эндоглюканазаны клондайтындығын дәлелдеу қажет ... Бұл үшін E.coli ... ... ... ... ... E.coli-дің эндоглюканазалық активтілігінің жоқ болуына негізделген болатын.
E.coli клеткаларында eng1 ген ... ... үшін Т7 ... ... негізделген экспрессия жүйесі қолданылды. Бактериалды клеткаларда A.niger ENG1 эндоглюканазасының синтезі үшін E. сoli-дің К-12 ... бір түрі ... ... ... Бұл ... ... ... бақылауында орналасқан Т7 РНК полимеразаны кодтайтын ген копиясы орналасқан. Rosetta(DE3) BL21 lacZY штаммының негізінде жасалынған, E. сoli-де сирек ... ... ... ететін эукариоттық белоктардың экспрессиясын жоғарылату үшін қолданылады. Бұл штамм құрамында ... ... үшін тРНҚ ... бар: AUA, AGG, AGA, CUA, CCC, ... ... экспрессиясын ДСН-ПААГ электрофорез және ферментативтілік активтілігін анықтау арқылы зерттедік. Индукцияны 0,2мМ ИПТГ ... ... ... ... анализін ИПТГ-мен индукцияға дейін және 12 сағат индукциядан кейін (түнгі дақыл) жүргіздік. 2x үлгі ... ... ... ... арқылы дайындалған белоктық сынамалардың электрофорезін 10% ДСН-ПААГ арқылы трис-глицин ... 12 V/см ... ... ... - ... 1 - бос pET11d векторы бар E. Coli ... ... ; 2-5- ... ... бар E. Coli-дің 12 h ИПТГ-мен инд. кейінгі клеткалық экстракт.
Сурет-15 - A. niger саңырауқұлағының E. Coli клеткаларындағы eng1 ... кДНҚ ... ... ... ... ИПТГ қатысуымен инкубацияланған трансформацияланған клеткалар ENG1 эндоглюканазаның молекулалық массасына сәйкес келетін белогын синтездейтіні анықталды. ... ... ... ... ... бар белоктың жинақталуы байқалмады. Бұл зерттелінген геннің эффективті экспрессиясының айқын дәлелі.
3.3 ENG1 ... ... ... белсенділігін анықтау
Еng1 генін экспрессиялайтын E. coli тотальды белок препатары оның ... ... ... ... ... ... Ферментативтіілік активтілігі КМЦ, авицел және фильтр қағазын реакцияның стандартты жағдайларында тексерілді. Рекомбинантты ENG1 ферменті КМЦ-ны гидролизге ... ... ... ... мен ... ... қарағандағы активтілігі нолге тең болып шықты. Бұл ... ... ... ... активтілікке ие екендігін көрсетеді (4-кесте).
Кесте 4 - Рекомбинантты ферменттің рН 6,0 және 50оC жағдайларында әртүрлі целлюлозды ... ... ... ... ... белок)
Авицел
0
Фильтр қағазы (Ватман №1, 1 х 6см )
0
КМЦ
1,23+-0,04
Қазіргі кезде белгілі болған ферменттердің ... үшін олар ... ... ... рН пен ... оптимумдары анықталған.(Сурет 16)
А ... - рН ... ... ... шамаларында анықталған: (натрий ацетат буфері (рН 4-6), натрий фосфат буфері (рН 6-7) және трис-глицин буфері (рН 9)); Б - ... ... рН-ы ... буферде анықталған.
Сурет 16 - ENG1 рекомбинантты белок активтілігіне рН және температураның әсері.
Фермент активтілігінің реакциялық ортаның рН-на тәуелділігі субстрат ... ... (СМС) ... ... Бұл үшін ... бар E.coli экстрактісін ИПТГ-мен 12 сағаттық инкубациядан кейін 50 оС 1сағ ішінде әртүрлі рН шамаларында инкубацияладық: (натрий-ацетат буфері (рН 4-6), ... ... (рН 6-7) және ... буфері (рН 9). Зерттеу нәтижелері бойынша, рекомбинантты фермент оптимальды активтілігін рН 6 болғанда ... ... бұл ... ... ... рН шамаларында да байқалады (16-сурет).
Ферменттің температуралық оптимумын реакциялық қоспаны 0,05М натрий фосфат буферінде (рН 6,0) 1 сағ ... ... (30-80 [о]С) ... ... анықтадық. Зерттеу нәтижелері көрсеткендей, рекомбинантты фермент активтілігі 50 оС ... ... ... A.niger ... ... ферментін (ENG1) кодтайтын ген клондалып, Т7 фагының реттелетін ... ... ... ... ... ... бола алатын E. coli штаммдары жасалынды.
ҚОРЫТЫНДЫ
* Эндоглюканаза ферментінің eng1 ... ... ... ... ... ...
* ... клондау үшін оптимальді вектор таңдап алынып, рекомбинантты кассеталық конструкциясы компьютерлік моделденді.
* ... niger ... ... ... ... ... алынып, электрофорездік анализі жасалынды. Кері транскрипция реакциясы және полимеразды тізбектік реакция әдістері көмегімен eng1 генінің кДНҚ-сы амплификацияланды.
* Қазақстанда тұңғыш рет ... niger ... eng1 ... ... E.coli ... ... E.coli клеткасының Rosetta(DE3) штаммында Aspergillus niger саңырауқұлағының eng1 генінің эффективті экспрессиясы жүргізілді.
* ДСН-ПААГелінде E.coli клеткасы Rosetta (DE3) ... ... ... ... ... ... ... электрофорезі жасалды.
* E. coli Rosetta (DE3) штаммында экспрессияланған ... ENG1 ... ... қабілетті екендігі және оптимальды каталитикалық белсенділігін рН 6 және 50 °С температурада көрсететіні анықталған.
ҚЫСҚАРТЫЛҒАН СӨЗДЕР ТІЗІМІ
A. niger - ... ... flavus - ... ... ... - Penicillium cyclopium
T. fusca - Trichoderma fusca
НҚ - нуклеин қышқылы
ДНҚ - ... ... - ... ... - ... ... ... - дезоксинуклеозидтрифосфат
мРНҚ - матрицалық рибонуклеин ... - кері ... ...
ПТР - полимеразды тізбектік реакция
КД - каталитикалық домен
ЦБД - ... ... ... - ... ортасы
EDTA - этилендиаминтетраацетат
КМЦ - ... ... - ... ... ... гелі
ПАЙДАЛАНЫЛҒАН ӘДЕБИЕТТЕР ТІЗІМІ
* Алешина Л.А., Глазкова С.В., Луговская Л.А., ... М.В., ... А.Д., ... Е.В. ... ... о ... ... // Химия растительного сырья. - 2001. №1: 5 - 36 б
* "Реставрация произведений ... ... им. ... М., 1995: 300 б
* А.П. ... А.В. ... В.М. Черноглазов. Биоконверсия лигноцеллюлозных материалов: Учеб. пособие. М.: Изд-воМГУ, 1995: 59-65 б
* Aspergillus niger ... // ... - ...
* ... ... анықтамасы // Internet. - http://en.wikipedia.org/wiki/Aspergillus
* Aspergillus niger саңырауқұлағының морфологиясы // Internet. - ... -
* В. В. ... Р. Ю. ... Н. В. ... "Исследование ферментативного гидролиза отходов переработки злаков", Ползуновский вестник, №3, 2008: ... ... Д. Д. ... ... ... terreus: ... множественных форм, их биосинтез и секреция". Диссертациялық жұмыс,1995:5 б
* М.Л. Рабинович, М.С. Мельник. "Хвостатые ферменты", Природа, №5, 2003: ... А.В. ... ... " О ... действия ферментов-целлюлаз на текстильные материалы: взгляд энзимологов". Текстильная химия, 1998: 52 б
* М. Л. Рабинович, М. С. ... ... в ... ... ферментов и механизм биодеградации высркрупорядоченных форм целлюлозы", Успехи биологической химии, т. 40, 2000: 205 б
* Л. С. ... ... и ее ... Химия. Мәскеу, 1996: 10б
* Б. Я. ... ДЖ. ... ... ... Мир 2002: 294-296 б
* ... Т., Фрич Э., ... Дж. ... клонирование. Методы генетической инженерии" - М.:Мир, 1984. - 463 б
* А. Е. ... Н. В. ... ... ... ... ... Мир, 2006: 407 - 409 б
* Клонирование ДНК. Методы. Под ред. Д. Гловера. - М.: Мир, 1988. - 538 ... J. Hong · H. Tamaki · K. Yamamoto · H. Kumagai Cloning of a gene encoding ... ... from ... ... and its expression in yeast.Appl. Microbiol. Biotechnol. (2003) 63:42-50 б
* Novagen pET system manual (11[th] edition) // Novagen, ... Promega ... notebook // Promega ... 2004.
* А.Г.Лобанок В.Г.Бабицкая Ж.Н.Богдановская. Микробный синтез на основе целлюлозы. Мәскеу, 1998: 38 б
* ... M. E., L. Andre, P. ... M. Bailey, T. T. Teeri, and J. K. C. Knowles. 1988. ... secretion of two fungal cellobiohydrolases by Saccharomyces cerevisiae. Gene 63:103-112.
* ... T., L. ... T. Nevanen, L. ... P. Kraulis, T. A. Jones, J. K. C. Knowles, and T. T. Teeri. 1992. ... of the function of mutated ... domains of Trichoderma reesei cellobiohydrolase I. Proteins Struct. Funct. Genet. 14:475-482.
* Saarilahti, H. T., B. Henrissat, and E. T. Palva. 1990. CelS: a novel ... ... from Erwinia ... subsp. carotovora. Gene 90:9-14.
* Sakamoto, S., G. Tamura, K. Ito, T. Ishikawa, K. Iwano, and N. Nishiya. 1995. Cloning and ... of ... cDNA from ... kawachii and its ... in ... ... Curr. Genet. 27:435-439.
* Saloheimo, A., B. Henrissat, A.-M. Hoffren, O. Teleman, and M. ... 1994. A novel, small ... gene, egl5, from ... reesei isolated by ... in yeast. Mol. ... ... Mel'nik, M. S., M. L. ... and Y. V. Voznyi. 1991. Cellobiohydrolase of Clostridium ... produced by a ... E. coli strain. ... 56:1787 - 1797. (English translation.)
* Kataeva, I., X. L. Li, H. Chen, S. K. Choi, and L. G. ... 1999. Cloning and sequence analysis of a new ... gene encoding CelK, a major ... ... of ... thermocellum: evidence for gene duplication and recombination. J. ... 181:5288 - ... ... M., L. Andre, M. ... P. ... and J. K. C. Knowles. 1987. ... of two ... reesei endoglucanases in yeast Saccharomyces cerevisiae. Yeast 3:175-185
ТҮЙІН
Бұл жұмыста Aspergillus niger ... ... гені ... ... ... ... ... E.coli клеткасының жүйесінде жүргізілген.
РЕЗЮМЕ
В данной работе проделано клонирование гена эндоглюканазы гриба Aspergillus niger и ген на ... ... ... в ... системе E.coli.
SUMMARY
This work is devoted to cloning of gene encoding endoglucanase from ... niger and its ... in E.coli.

Пән: Автоматтандыру, Техника
Жұмыс түрі: Дипломдық жұмыс
Көлемі: 40 бет
Бұл жұмыстың бағасы: 1 000 теңге









Ұқсас жұмыстар
Тақырыб Бет саны
Дрожжыларды көбейтудегі теориялық негiздер4 бет
Әл – Фараби атындағы Қазақ Ұлттық Университетінің Биология мұражайындағы омыртқалы жануарлардың био алуан түрлілігі54 бет
«Бек+» ЖШС шарттарындағы әр түрлі ізге жататын сиырлардың сүт өнімділігі49 бет
«Саңырауқұлақтардың халық, медицина, өндіріс орндарындағы рөлі»29 бет
Ағзаларды клондау9 бет
Буылтық құрттар типіне жататын жәндіктердің негізгі ерекшеліктері4 бет
В тобына жататын витаминдер12 бет
Жануарлардың гендерінің сипаттамасы22 бет
Клондау3 бет
Клондау әдісі15 бет


Исходниктер
Пәндер
Көмек / Помощь
Арайлым
Біз міндетті түрде жауап береміз!
Мы обязательно ответим!
Жіберу / Отправить


Зарабатывайте вместе с нами

Рахмет!
Хабарлама жіберілді. / Сообщение отправлено.

Сіз үшін аптасына 5 күн жұмыс істейміз.
Жұмыс уақыты 09:00 - 18:00

Мы работаем для Вас 5 дней в неделю.
Время работы 09:00 - 18:00

Email: info@stud.kz

Phone: 777 614 50 20
Жабу / Закрыть

Көмек / Помощь